Instructions to use gbrixi/minerva-mlm-8k with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- Transformers
How to use gbrixi/minerva-mlm-8k with Transformers:
# Use a pipeline as a high-level helper from transformers import pipeline pipe = pipeline("fill-mask", model="gbrixi/minerva-mlm-8k", trust_remote_code=True)# Load model directly from transformers import AutoModelForMaskedLM model = AutoModelForMaskedLM.from_pretrained("gbrixi/minerva-mlm-8k", trust_remote_code=True, device_map="auto") - Notebooks
- Google Colab
- Kaggle
Minerva-MLM
Minerva-MLM is a genome language model for coevolutionary mining. The checkpoint includes the masked language model head and three interaction heads for base-pairing, repeat, and structure signals.
Full documentation, finetuning scripts, notebooks, and setup are on the github.
Checkpoints
| Model | Context length | Hugging Face repo |
|---|---|---|
| Minerva-MLM | 4,096 tokens | gbrixi/minerva-mlm |
| Minerva-MLM-8k | 8,192 tokens | gbrixi/minerva-mlm-8k |
Install
Inference from this repo needs only Transformers and PyTorch:
pip install "transformers>=4.41" torch safetensors
pip install flash-attn # optional, recommended for production and packed sequences
flash-attn is picked up automatically when present, otherwise Minerva falls
back to PyTorch SDPA. The optional minerva-dna package adds plotting helpers,
GenBank utilities and finetuning wrappers, and lets you load the model without
trust_remote_code:
pip install minerva-dna
Quick Start
import torch
from transformers import AutoModelForMaskedLM, AutoTokenizer
repo = "gbrixi/minerva-mlm" # or "gbrixi/minerva-mlm-8k" for 8k context
device = "cuda" if torch.cuda.is_available() else "cpu"
model = AutoModelForMaskedLM.from_pretrained(
repo,
trust_remote_code=True,
torch_dtype=torch.bfloat16,
).to(device).eval()
tokenizer = AutoTokenizer.from_pretrained(repo)
sequence = "cgcggggtggagcagcctggtagctcgtcgggctcataacccgaagatcgtcggttcaaatccggcccccgcaacca"
tokens = tokenizer(f"<+>{sequence.lower()}", return_tensors="pt").to(model.device)
with torch.no_grad():
outputs = model(**tokens, output_interactions=True)
base_pairing = outputs.interactions["base_pairing"] # [batch, L, L]
protein = outputs.interactions["protein"] # [batch, L, L]
repeat = outputs.interactions["repeat"] # [batch, L, L]
logits = outputs.logits # [batch, L, vocab]
With minerva-dna installed, import the class directly and drop
trust_remote_code:
from minerva import MinervaForMaskedLM
model = MinervaForMaskedLM.from_pretrained(
repo, torch_dtype=torch.bfloat16,
).to(device).eval()
Strand Orientation
Minerva was trained with positive-strand DNA. To intepret unknown loci, run inference on both strands and compare results (or combine maps downstream):
def reverse_complement(seq: str) -> str:
return seq.lower().translate(str.maketrans("acgtn", "tgcan"))[::-1]
strands = {
"forward": f"<+>{sequence.lower()}",
"reverse_complement": f"<+>{reverse_complement(sequence)}",
}
results = {}
for name, seq in strands.items():
tokens = tokenizer(seq, return_tensors="pt").to(model.device)
with torch.no_grad():
outputs = model(**tokens, output_interactions=True)
results[name] = outputs.interactions
For mixed DNA/protein token strings, minerva.sequence_utils.extract_fwd_rc_attention aligns and combines forward and reverse-complement attention maps automatically (requires pip install minerva-dna).
Interaction Outputs
Set output_interactions=True to return all three standard Minerva interaction maps:
base_pairing: RNA base-pairing contactsprotein: protein contact predictionrepeat: repeat element signal
By default, Minerva uses the last-2-layer interaction heads:
outputs = model(**tokens, output_interactions=True)
To plot the interaction-head outputs (requires pip install minerva-dna):
from minerva.visualization import plot_interactions
token_list = tokenizer.convert_ids_to_tokens(tokens["input_ids"][0].tolist())
plot_interactions(outputs.interactions, tokens=token_list)
Six-layer heads are available with interaction_layers=6.
Jacobian Fingerprinting
get_fingerprints returns named interaction-pattern channels for a sequence,
computing the categorical Jacobian internally.
fp = model.get_fingerprints(sequence, tokenizer, position_range=(0, 96))
fp.channel_names # ["basepairing", "repeat", "protein", "other"]
basepairing = fp["basepairing"] # [L, L]
Raw Jacobians, plotting helpers and the rest of the API are documented in the repository.
Finetuning
Finetuning scripts, LoRA support, and GenBank ingestion live in the GitHub repository. See scripts/finetune.py and the README there for full examples with accelerate and PEFT.
Limitations
- Model performance is best on the positive DNA strand (
<+>prefix). When orientation is unknown, run inference on both strands. trust_remote_code=Trueis needed only withoutminerva-dnainstalled (see Install).
Citation
TODO: Add the paper citation before public release.
License
Apache 2.0. Minerva-MLM is initialized from gLM2 650M (Tatta Bio, Apache 2.0) and adopts its mixed-modality tokenization.
- Downloads last month
- 86
Model tree for gbrixi/minerva-mlm-8k
Base model
gbrixi/minerva-mlm